Skip to main content

Table 1 PCR primers, degeneracy and annealing temperatures (Ta).

From: Fast and non-invasive PCR sexing of primates: apes, Old World monkeys, New World monkeys and Strepsirrhines

Primer name Primer sequence (5'-3')1 Degeneracy Ta°C
UTX/UTY TGCTACCTCAGGTGGACAACAAGG 1 62
UTY TGCTTGTTTCAGGCACCAAGGR TCTATK 4 62
UTX CTCGACACTGGCAGTGCTGTTAGG 1 62
  1. 1Degenerate nucleotides are shown in bold.