Skip to main content

Table 1 Diagnostic primers used for identification of Caenorhabditis species or genus

From: The prevalence of Caenorhabditis elegans across 1.5 years in selected North German locations: the importance of substrate type, abiotic parameters, and Caenorhabditis competitors

Primer name Primer sequence 5’-3’ Anneal Ta Target region Specificity Sizeb Reference
nlp30-F ACACATACAACTGATCACTCA 55°C nlp-30 C. elegans 154 bp This study
nlp30-R TACTTTCCCCATCCGTATC
zeel/peel-leftF CTGAAGCATGCCGGATTTAT 59°C Region with zeel-1 + peel-1 C. elegans 940 bp [24] and this study
zeel/peel-leftR TCCGTCCAATATTCAATCGAC
Cre-ITS2-F1 TTGTCGGGCGGCATTGGGGCT 65°C Ribosomal ITS2 C. remanei 300 bp This study
Cre-ITS2-R4 CGTCGTCTTCCTTACCCCGAA
Cbriggsae-F GAACCTGCGAGTGCATG 56°C glp-1 C. briggsae 302 bp [22]
Cbriggsae-R CCGTCTGCAAACGAACGGGC
KK5.8S-1 CTGCGTTACTTACCACGAATTGCARAC 70°C Ribsomal ITS2 Caenorhabditis 2008 bp [14]
KK28S-4 GCGGTATTTGCTACTACCAYYAMGATCTGC
  1. aOptimized annealing temperature for diagnostic PCR.
  2. bPCR product size.