The prevalence of Caenorhabditis elegans across 1.5 years in selected North German locations: the importance of substrate type, abiotic parameters, and Caenorhabditis competitors

Table 1 Diagnostic primers used for identification of Caenorhabditis species or genus

Primer name	Primer sequence 5’-3’	Anneal T^a	Target region	Specificity	Size^b	Reference
nlp30-F	ACACATACAACTGATCACTCA	55°C	nlp-30	C. elegans	154 bp	This study
nlp30-R	TACTTTCCCCATCCGTATC	55°C	nlp-30	C. elegans	154 bp	This study
zeel/peel-leftF	CTGAAGCATGCCGGATTTAT	59°C	Region with zeel-1 + peel-1	C. elegans	940 bp	[24] and this study
zeel/peel-leftR	TCCGTCCAATATTCAATCGAC	59°C	Region with zeel-1 + peel-1	C. elegans	940 bp	[24] and this study
Cre-ITS2-F1	TTGTCGGGCGGCATTGGGGCT	65°C	Ribosomal ITS2	C. remanei	300 bp	This study
Cre-ITS2-R4	CGTCGTCTTCCTTACCCCGAA	65°C	Ribosomal ITS2	C. remanei	300 bp	This study
Cbriggsae-F	GAACCTGCGAGTGCATG	56°C	glp-1	C. briggsae	302 bp	[22]
Cbriggsae-R	CCGTCTGCAAACGAACGGGC	56°C	glp-1	C. briggsae	302 bp	[22]
KK5.8S-1	CTGCGTTACTTACCACGAATTGCARAC	70°C	Ribsomal ITS2	Caenorhabditis	2008 bp	[14]
KK28S-4	GCGGTATTTGCTACTACCAYYAMGATCTGC	70°C	Ribsomal ITS2	Caenorhabditis	2008 bp	[14]

ISSN: 1472-6785