From: Identification of the vascular plants of Churchill, Manitoba, using a DNA barcode library
PCR recipe for rbc L and ITS2 (total volume of the reaction: 12.5 μL) | ||
---|---|---|
Reagents | Final concentration | Volume per reaction (μL) |
10% trehalose | 5% | 6.25 |
ddH20 | Â | 2.00 |
10X buffer | 1x | 1.25 |
50 mM MgCl2 | 2.5 mM | 0.625 |
10 μM primer F | 0.1 | 0.125 |
10 μM primer R | 0.1 | 0.125 |
10 mM dNTPs | 0.05 | 0.0625 |
Polymerase (5 U/μl) | 0.024 U/μL | 0.06 |
TOTAL | Â | 10.50 |
DNA template (20-40 ng/μL) |  | 2 .00 |
PCR recipe for mat K (total volume of the reaction: 7.5 μL) | ||
Reagents | Final concentration | Volume per reaction(μL) |
20% trehalose | 5% | 1.875 |
ddH20 | Â | 2.60 |
10X buffer | 1x | 0.75 |
50 mM MgCl2 | 1.5 mM | 0.225 |
10 μM primer F | 0.5 | 0.375 |
10 μM primer R | 0.5 | 0.375 |
10 mM dNTPs | 0.2 | 0.15 |
Polymerase (5 U/μl) | 0.1 U/μL | 0.15 |
TOTAL | Â | 6.50 |
DNA template (2-4 ng/μL) |  | 1.00 |
Primer sets | ||
 | Sequence | Reference |
rbc L primers | ||
rbcLa-F | ATGTCACCACAAACAGAGACTAAAGC | [49] Levin et al. 2003 |
rbcLa-R | GTAAAATCAAGTCCACCRCG | [16] Kress & Erickson, 2009 |
mat K primers | ||
MatK-1RKIM-f | ACCCAGTCCATCTGGAAATCTTGGTTC | Ki-Joong Kim, pers. comm. |
MatK-3FKIM-r | CGTACAGTACTTTTGTGTTTACGAG | Ki-Joong Kim, pers. comm. |
MatK_390f | CGATCTATTCATTCAATATTTC | [51] Cuenoud et al. 2002 |
MatK_1326r | TCTAGCACACGAAAGTCGAAGT | [51] Cuenoud et al. 2002 |
ITS2 primers | ||
ITS2-S2F | ATGCGATACTTGGTGTGAAT | [17] Chen et al. 2010 |
ITS4 | TCCTCCGCTTATTGATATGC | [50] White et al. 1990 |